Çam (Pinus sp.) türlerinde genetik polimorfizmin DNA markır teknolojisi ile tanımlanması
dc.contributor.advisor | Akçin, Abdulkadir | |
dc.contributor.author | Şentürk, Funda | |
dc.date.accessioned | 2021-05-07T12:30:14Z | |
dc.date.available | 2021-05-07T12:30:14Z | |
dc.date.submitted | 1997 | |
dc.date.issued | 2021-01-29 | |
dc.identifier.uri | https://acikbilim.yok.gov.tr/handle/20.500.12812/621592 | |
dc.description.abstract | OZET Pimus pinaster, Pinus sylvestris, Pimis nigra, Pinus brutia ve Pinus pinecfmn yapraklarından izole edilen genomik DNA kullanılarak bu çam ağaç türleri arasındaki genetik polimorfizm RAPD analizleri ile belirlendi. RAPD analizlerinde otuzbir tane farklı primer denendi. Bu primerlerden sadece oniki tanesinde çoğaltılmış bantlar elde edildi. GYTE 9 (51 CTGCAGTGGCTTTCACCTTC 31) primerinin kullamldığı RAPD analizinde homomorfik bantlar elde edilirken diğer onbir primerle yapılan RAPD analizlerinde heteromorfik bantlar elde edildi. TUB 365 (5' GGACTGGAGT 3!) primerinin sağladığı heteromorfik bantlar ile bu beş farklı çam türünü aynı anda moleküler düzeyde birbirinden ayırmak mümkün oldu. Türler arasında en yüksek polimorfizm değerinin, Pinus nigra ile Pinus pinaster arasında %52.75, en düşük polimorfizm değerinin ise Pinus nigra ile Pinus sylvestris arasında % 28.25 oranında olduğu hesaplandı. Yapısında fazla miktarda fenolik maddeler bulunan çam yapraklarından DNA izolasyon yöntemlerinin geliştirilmesi ve özellikle genetik düzeyde polimorfizmi belirlemede kullanılabilecek uygun primerlerin saptanması, farklı çam genotiplerinde yapılacak moleküler genetik çalışmalarına katkıda bulunacaktır. | |
dc.description.abstract | SUMMARY In this study, genetic polymorphism was studied on five different pine species; P. pinaster, P. sylvestris, P. nigra, P. brutia, and P. pinea. The genomic DNA isolated Scorn needles was used to determine genetic polymorphism among different pine species by using RAPD (Random Amplified polymorphic DNA) analysis. Thirty-one primers chosen arbitrarly were used to amplify genomic DNA Among these primers, twelve primers produced expected bands on analytic gel. Primer GYTE 9 (5' CTGCAGTGGCTTTCACCTTC 31) homomorphic bands for all tested genotypes. However, primer TUB 365 (51 GGACTGGAGT 31) produced polymorphic RAPD bands for these genotypes. Then the rate of polymorphism was calculated. According to results, the highest polymorphism rate was 52.75% between P. nigra and P. pinaster. The lowest polymorphism was 28.25% between P. nigra and P. sylvestris. Developing techniques for DNA isolation from highly phenolic pinus needles and in particular obtaining proper primers which will be used in the determination of polymorphism will provide an essential contribution to the genetic research in the field of Pinus genotypes. | en_US |
dc.language | Turkish | |
dc.language.iso | tr | |
dc.rights | info:eu-repo/semantics/embargoedAccess | |
dc.rights | Attribution 4.0 United States | tr_TR |
dc.rights.uri | https://creativecommons.org/licenses/by/4.0/ | |
dc.subject | Biyoloji | tr_TR |
dc.subject | Biology | en_US |
dc.title | Çam (Pinus sp.) türlerinde genetik polimorfizmin DNA markır teknolojisi ile tanımlanması | |
dc.type | masterThesis | |
dc.date.updated | 2021-01-29 | |
dc.contributor.department | Biyoloji Ana Bilim Dalı | |
dc.subject.ytm | DNA analysis | |
dc.subject.ytm | Pine | |
dc.subject.ytm | Genetics | |
dc.subject.ytm | Polymorphism-genetic | |
dc.identifier.yokid | 66014 | |
dc.publisher.institute | Mühendislik ve Fen Bilimleri Enstitüsü | |
dc.publisher.university | GEBZE YÜKSEK TEKNOLOJİ ENSTİTÜSÜ | |
dc.identifier.thesisid | 66014 | |
dc.description.pages | 66 | |
dc.publisher.discipline | Diğer |