Sensörinöral işitme kayıpları ile connexin 26 35 delG mutasyonu arasındaki ilişki
dc.contributor.advisor | Aslan, Asım | |
dc.contributor.author | Hirçin, Hasan Zafer | |
dc.date.accessioned | 2021-05-07T09:01:05Z | |
dc.date.available | 2021-05-07T09:01:05Z | |
dc.date.submitted | 2010 | |
dc.date.issued | 2018-08-06 | |
dc.identifier.uri | https://acikbilim.yok.gov.tr/handle/20.500.12812/603057 | |
dc.description.abstract | İşitme kaybı, en sık görülen duyu bozukluklarından biri olup, insidansı yaklaşık 1/1000'dir. Prevelansı yaşa bağlı olarak artmaktadır ve yaşlılıkta en sık görülen duyu bozukluğudur. Non sendromik işitme kaybına neden olan genler içinde en önemli yeri, otozomal resesif kalıtılan (DFNB) DFNB 1 lokusunda sorumlu gen olan Connexin 26 (GJB2 / Cx26) tutmaktadır. Beyaz ırkta Cx26 geninde en sık görülen mutasyon 35delG'dir. Yaşlılık tipi işitme kaybı, diğer adıyla presbiakuzi, en sık simetrik, bilateral ve yüksek frekanslarda daha belirgin olarak seyreder. Prevelansı 61- 70 yaş arasında %37 iken 71- 80 yaş arasında %60'dır. YTİK'in etiyolojisinde genetik ve çevresel faktörler yer almaktadır. Biz çalışmamızda sensörinöral işitme kaybı, özellikle da YTİK ile Connexin 26 35delG mutasyonu arasındaki ilişkiyi araştırdık.Bu çalışma kapsamında, yaşlılık tipi işitme kaybı tespit ettiğimiz 34 hasta, bilateral sensörinöral işitme kaybı tesbit edilmiş 45 yaş altında olan 35 hasta, tek taraflı sensörinöral işitme kaybı tesbit edilmiş 17 hasta ve 34 sağlıklı birey, Cx26 geninde görülen 35delG mutasyonu açısından incelenmiştir. Hastalardan alınan tam kan örneklerinden HighPure PCR Template Preparation Kit (Cat. No: 11796828001, Roche Diagnostic, Germany) kullanılarak DNA izolasyonu yapıldı. Realtime polimeraz zincir reaksiyonu(PCR) primerleri; PCR-primer forward: AGTCTCCCTGTTCTGTCCTAGCT ve PCR-primer reversed: CTTTCCAATGCTGGTGGAGTG ve Florasan Labeled probe: TTCACACCCCCCAG, Anchor Probe: TCGTCTGCAGCGTGCCCCAAATCCATCTTCT olarak TIB MOLBIOL GmbH (Eresburgstraße 22-23 D-12103 Berlin) firmasına yaptırıldı.İstatistiksel analizler için SPSS (Statistical Package for Social Sciences) for Windows 17.0 programı kullanıldı. Çalışma verileri tablo ile özetlendi. Niteliksel olan Connexin 26 35 delG mutasyonu dağılımının karşılaştırmasında Chi-Square testi kullanıldı.Hasta grubunda Connexin 26 35 delG mutasyonu olan 1 (%2,9) olgu var iken , kontrol grubunda Connexin 26 35 delG mutasyonu olan hiçbir olguya rastlanmamış olup, bu dağılım istatistiksel açıdan değerlendirildiğinde hasta ve kontrol grubundaki Connexin 26 35 delG mutasyonu dağılımları arasında istatistiksel olarak anlamlı bir fark saptayamadık. | |
dc.description.abstract | Hearing impairment is one of the most common sensory impairment and incidence of hearin loss is 1/1000. Prevelance of hearing loss increases due to age and it is the most common sensorial disorder among the elderly. The most important role causing non-syndromic hearing loss is Coonnexin 26(GJB2/Cx26) gene which is encoded autosomal recessive (DFNB1). The most frequent mutation inthe Caucasians. In its most typical presentation of age related hearing impairment (ARHI) alias presbycusis, symetrical, sensorineural and more pronounced in the high frequencies. The prevelance of hearing loss is 37% for people aged 61 to 70, and it is 60% for people aged 71 to 80 years. Enviromentel and genetic factors contribute to the etiology of the ARHI. We study the relation between sensorineural hearing impairment especially ARHI and Connexin 26 35delG mutation.In this study, 34 patients with ARHI, 35 patients under 45 years old with bilateral sensorineural hearing loss, 17 patients with unilateral hearing loss and 34 healthy volunteers .analyzed for Cx26 35delG mutation. The blood samples analysed with HighPure PCR Template Preparation Kit (Cat. No: 11796828001, Roche Diagnostic, Germany), DNA isolation was performed. Realtime polmerase chain reaction(PCR) primers; PCR-primer forward: AGTCTCCCTGTTCTGTCCTAGCT and PCR-primer reversed: CTTTCCAATGCTGGTGGAGTG ve Florasan Labeled probe: TTCACACCCCCCAG, Anchor Probe: TCGTCTGCAGCGTGCCCCAAATCCATCTTCT analyzed by TIB MOLBIOL GmbH (Eresburgstraße 22-23 D-12103 Berlin) company.SPSS(Statistical Package for Social Sciences) for windows 17.0 program was used for the statistical analyses. The datas were summarized with a table. To compare the distribution of Connexin 26 35delG mutation Chi- Square test was used.In the ARHI study group we could identify Cx26 35delG mutation in only 1(2,9%) case. In control group there is no mutant gene. When we analysed this data statistically, we could not identify any relation between patient and control groups. | en_US |
dc.language | Turkish | |
dc.language.iso | tr | |
dc.rights | info:eu-repo/semantics/openAccess | |
dc.rights | Attribution 4.0 United States | tr_TR |
dc.rights.uri | https://creativecommons.org/licenses/by/4.0/ | |
dc.subject | Kulak Burun ve Boğaz | tr_TR |
dc.subject | Otorhinolaryngology (Ear-Nose-Throat) | en_US |
dc.title | Sensörinöral işitme kayıpları ile connexin 26 35 delG mutasyonu arasındaki ilişki | |
dc.title.alternative | Connexin26 35 delG mutation and sensorineural hearing loss | |
dc.type | doctoralThesis | |
dc.date.updated | 2018-08-06 | |
dc.contributor.department | Kulak Burun Boğaz Ana Bilim Dalı | |
dc.subject.ytm | Hearing loss | |
dc.subject.ytm | Hearing loss-sensorineural | |
dc.subject.ytm | Connexins | |
dc.subject.ytm | Genes | |
dc.subject.ytm | Mutation | |
dc.identifier.yokid | 386321 | |
dc.publisher.institute | Tıp Fakültesi | |
dc.publisher.university | CELÂL BAYAR ÜNİVERSİTESİ | |
dc.type.sub | medicineThesis | |
dc.identifier.thesisid | 267940 | |
dc.description.pages | 38 | |
dc.publisher.discipline | Diğer |